AACUCUUUCUUAUGUCUUGUU
| Count | Sample ID | Experiment title |
|---|---|---|
| 3 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 2 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM149080 | Small RNAs in Arabidopsis thaliana and its RISC complexes |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |